Archives

  • 2026-08
  • 2026-07
  • 2026-06
  • 2026-05
  • 2026-04
  • 2026-03
  • 2026-02
  • 2026-01
  • 2025-12
  • 2025-11
  • 2025-10
  • 2025-09
  • 2025-04
  • 2025-03
  • 2025-02
  • 2025-01
  • 2024-12
  • 2024-11
  • 2024-10
  • 2024-09
  • 2024-08
  • 2024-07
  • 2024-06
  • 2024-05
  • 2024-04
  • 2024-03
  • 2024-02
  • 2024-01
  • 2023-12
  • 2023-11
  • 2023-10
  • 2023-09
  • 2023-08
  • 2023-06
  • 2023-05
  • 2023-04
  • 2023-03
  • 2023-02
  • 2023-01
  • 2022-12
  • 2022-11
  • 2022-10
  • 2022-09
  • 2022-08
  • 2022-07
  • 2022-06
  • 2022-05
  • 2022-04
  • 2022-03
  • 2022-02
  • 2022-01
  • 2021-12
  • 2021-11
  • 2021-10
  • 2021-09
  • 2021-08
  • 2021-07
  • 2021-06
  • 2021-05
  • 2021-04
  • 2021-03
  • 2021-02
  • 2021-01
  • 2020-12
  • 2020-11
  • 2020-10
  • 2020-09
  • 2020-08
  • 2020-07
  • 2020-06
  • 2020-05
  • 2020-04
  • 2020-03
  • 2020-02
  • 2020-01
  • 2019-12
  • 2019-11
  • 2019-10
  • 2019-09
  • 2019-08
  • 2019-07
  • 2018-07
  • FLAG tag Peptide (DYKDDDDK): Benchmarks, Mechanism, and W...

    2025-10-28

    FLAG tag Peptide (DYKDDDDK): Atomic Facts, Mechanism, and Workflow Integration

    Executive Summary: The FLAG tag Peptide (DYKDDDDK) is a synthetic, 8-amino acid sequence widely used as an epitope tag for recombinant protein purification and detection (A6002 kit). It offers solubility exceeding 210.6 mg/mL in water and greater than 50.65 mg/mL in DMSO at room temperature, supporting a range of biochemical workflows (Tang et al., 2025). The peptide’s enterokinase-cleavage site allows gentle elution of tagged proteins from anti-FLAG M1 and M2 affinity resins. Mass spectrometry and HPLC confirm >96.9% purity. Its use is validated in protocols isolating intact, functional protein complexes from eukaryotic systems, such as the human Mediator complex (Tang et al., 2025).

    Biological Rationale

    The FLAG tag Peptide (sequence: DYKDDDDK) is engineered for post-expression detection and purification of recombinant proteins in diverse host systems. Its small size (8 amino acids; ~1 kDa) minimizes perturbation to protein folding or function (Tang et al., 2025). The tag is recognized specifically by high-affinity monoclonal antibodies, enabling selective isolation from cellular extracts. Unlike larger fusion tags, the FLAG sequence does not typically interfere with subunit assembly or enzymatic activity. The presence of an enterokinase recognition site (DDDDK) enables post-purification removal of the tag, yielding native protein for downstream applications. The tag’s negative charge (due to aspartic acid residues) further reduces non-specific interactions in affinity workflows (Related analysis).

    Mechanism of Action of FLAG tag Peptide (DYKDDDDK)

    The FLAG tag peptide functions as a short, linear epitope recognized by anti-FLAG monoclonal antibodies (e.g., M1, M2). These antibodies, immobilized on agarose or magnetic supports, bind specifically to the DYKDDDDK motif fused to a target protein. During affinity purification, only FLAG-tagged proteins are retained, allowing stringent washing to remove contaminants. Elution is achieved by competitive displacement using synthetic FLAG peptide (DYKDDDDK) at typical concentrations of 100 μg/mL, or by proteolytic cleavage at the enterokinase site. This approach preserves protein complex integrity and activity due to mild buffer conditions (Tang et al., 2025).

    Evidence & Benchmarks

    • The C-terminal FLAG tag (DYKDDDDK) does not affect kinase activity or structural stability of CDK8 within the human Mediator complex (Tang et al., 2025, DOI link).
    • FLAG tag peptide exhibits solubility >50.65 mg/mL in DMSO, 210.6 mg/mL in water, and 34.03 mg/mL in ethanol at 20 °C, supporting concentrated elution protocols (Product specifications).
    • HPLC and mass spectrometry confirm peptide purity >96.9% for A6002, ensuring batch-to-batch reproducibility (Product page).
    • Purification workflows using anti-FLAG M2 affinity gel enable isolation of multi-subunit protein complexes, e.g., the CKM-cMED complex from FreeStyle 293-F cells (Tang et al., 2025, DOI link).
    • The FLAG tag sequence (DYKDDDDK) is routinely encoded at the DNA level (GACTACAAAGACGACGACGACAAG) for direct fusion to coding sequences (Product documentation).

    Applications, Limits & Misconceptions

    The FLAG tag peptide is applied in purification and detection of recombinant proteins, especially when maintaining protein function is critical. It is compatible with Western blotting, immunoprecipitation, and immunofluorescence. The tag’s small size allows its use in multi-tag workflows. However, it is not suitable for eluting 3X FLAG–tagged proteins, which require a 3X FLAG peptide for efficient competition (Product page). Long-term storage of peptide solutions is discouraged due to hydrolysis risk; instead, prepare fresh working aliquots. The negatively charged sequence may not be optimal for all protein-protein interaction contexts, especially with highly acidic targets (Contrast: troubleshooting strategies in complex mixtures).

    Common Pitfalls or Misconceptions

    • The standard FLAG peptide (DYKDDDDK) does not displace 3X FLAG–tagged proteins; use a 3X FLAG peptide for those constructs (A6002 kit guidance).
    • Prolonged storage of reconstituted peptide solutions reduces activity due to degradation; always use freshly prepared solutions.
    • The FLAG tag sequence may be cleaved by endogenous enterokinase-like proteases in some expression systems, requiring careful construct design.
    • High concentrations of competing peptide may elute weakly interacting non-FLAG proteins; optimal wash steps and controls are essential (Contrast: mechanistic troubleshooting).
    • Incorrect DNA or peptide sequence leads to poor antibody recognition; verify sequence integrity at both levels.

    Workflow Integration & Parameters

    Typical FLAG tag workflows start with recombinant construct design, incorporating the DYKDDDDK sequence at the N- or C-terminus via its DNA coding sequence. Expression is performed in E. coli, yeast, insect, or mammalian cells. After lysis, the tagged protein is captured using anti-FLAG M1 or M2 affinity resin. Elution is achieved with 100 μg/mL synthetic FLAG peptide in compatible buffer, or by enterokinase cleavage at the DDDD|K site. The peptide is supplied as a solid, stored desiccated at -20 °C, and should be dissolved immediately before use. Solubility supports high-concentration preparations for efficient elution. For multi-tag or sequential affinity workflows, the FLAG tag is compatible with His, HA, or Myc tags (Contrast: multi-tag purification guidance).

    Conclusion & Outlook

    The FLAG tag Peptide (DYKDDDDK) remains a gold standard for precision recombinant protein purification and detection, as evidenced by robust biochemical protocols and peer-reviewed benchmarks (Tang et al., 2025). Its solubility, purity, and compatibility with gentle elution strategies underpin its role in high-fidelity structural and functional studies. Ongoing innovations in affinity reagents and multi-tag workflows further expand its utility in complex protein science applications.